Encomenda rápida

Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano TFAP2C Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_003222.3
    Tamanho de cDNA:1353bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) with N terminal Myc tag.
    Sinónimo de gene:ERF1, TFAP2G, hAP-2g, AP2-GAMMA, TFAP2C
    Espécie:Human
    Vetor:pCMV3-N-Myc
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TFAP2C qPCR primers for gene expression analysis, HP101736 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13115-ACG$225
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13115-ACR$225
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG13115-ANG$225
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG13115-ANR$225
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13115-CF$195
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13115-CH$195
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13115-CM$195
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13115-CY$195
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de expressão)HG13115-G$75
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13115-NF$195
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13115-NH$195
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13115-NM$195
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13115-NY$195
    Humano TFAP2C / AP2-GAMMA clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13115-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    TFAP2C, also known as AP2-GAMMA, is a member of the activating protein 2 family of transcription factors. AP-2 factors bind to the consensus sequence 5'-GCCNNNGGC-3' and activate genes involved in a large spectrum of important biological functions including proper eye, face, body wall, limb and neural tube development. They also suppress a number of genes including MCAM/MUC18, C/EBP alpha and MYC. TFAP2C may be prognostic indicators for patients with breast tumors. TFAP2C gene has been tested for association to diseases (Breast Neoplasms; Carcinoma) and proposed to participate in processes (cell-cell signaling, male gonad development, regulation of transcription from RNA polymerase II promoter). Proteins are expected to have molecular functions (DNA binding, protein binding, protein dimerization activity, transcription factor activity) and to localize in various compartments (membrane, nucleus).

    Referências
  • Woodfield GW, et al. (2009) Interaction of TFAP2C with the estrogen receptor-alpha promoter is controlled by chromatin structure. Clin Cancer Res. 15 (11): 3672-9.
  • Zhao C, et al. (2003) Elevated expression levels of NCOA3, TOP1, and TFAP2C in breast tumors as predictors of poor prognosis. Cancer. 98 (1): 18-23.
  • Woodfield GW, et al. (2007) TFAP2C controls hormone response in breast cancer cells through multiple pathways of estrogen signaling. Cancer Res. 67 (18): 8439-43.
  • Penna E, et al. (2011) microRNA-214 contributes to melanoma tumour progression through suppression of TFAP2C. EMBO J. 30 (10): 1990-2007.
  • Woodfield GW, et al. (2010) Identification of primary gene targets of TFAP2C in hormone responsive breast carcinoma cells. Genes Chromosomes Cancer. 49 (10): 948-62.
  • Size / Price
    Catálogo: HG13115-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"