After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human TBCA Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC018210
Tamanho de cDNA:327bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens tubulin folding cofactor A with C terminal Flag tag.
Sinónimo de gene:TBCA
Espécie:Human
Vetor:pCMV3-C-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13918-ACG$225
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13918-ACR$225
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG13918-ANG$225
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG13918-ANR$225
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13918-CF$195
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13918-CH$195
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13918-CM$195
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13918-CY$195
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de expressão)HG13918-G$75
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13918-NF$195
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13918-NH$195
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13918-NM$195
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13918-NY$195
Humano Tubulin folding cofactor A clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13918-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Tubulin folding cofactor A belongs to the TBCA family. It is one of four proteins (cofactors A, D, E, and C) involved in the early step of the tubulin folding pathway. These proteins can fold intermediates and finally lead to correctly folded beta-tubulin. It is believed that tubulin folding cofactors A and D play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Tubulin folding cofactor E binds to the cofactor D/beta-tubulin complex; interaction with tubulin folding cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state.

Referências
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Irwin DM, et al. (2003) Molecular evolution of vertebrate goose-type lysozyme genes. J Mol Evol. 56(2):234-42.
  • Sklar P, et al. (2011) Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nat Genet. 43(10):977-83.
  • Size / Price
    Catálogo: HG13918-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"