After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human SUB1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC010537
Tamanho de cDNA:384bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens SUB1 homolog (S. cerevisiae) with N terminal Myc tag.
Sinónimo de gene:MGC102747, P15, PC4, p14, SUB1
Espécie:Human
Vetor:pCMV3-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14326-ACG$225
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14326-ACR$225
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14326-ANG$225
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14326-ANR$225
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14326-CF$195
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14326-CH$195
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14326-CM$195
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14326-CY$195
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14326-G$75
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14326-NF$195
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14326-NH$195
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14326-NM$195
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14326-NY$195
Humano SUB1 / PC4 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14326-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

SUB1 belongs to the transcriptional coactivator PC4 family. It is a general coactivator that functions cooperatively with TAFs and mediates functional interactions between upstream activators and the general transcriptional machinery. SUB1 binds single-stranded DNA. Single-stranded DNA-binding proteins play many roles in nucleic acid metabolism, but their importance during transcription remains unclear. SUB1 exhibits strong genetic interactions with factors necessary for promoter melting. It localizes near the transcription bubble in vitro and binds to promoters in vivo dependent upon preinitiation complexes assembly. SUB1 interacts with the nontemplate strand of RNApII complexes during initiation. It may also be involved in stabilizing the multiprotein transcription complex.

Referências
  • Knaus R, et al. (1996) Yeast SUB1 is a suppressor of TFIIB mutations and has homology to the human co-activator PC4. EMBO J. 15(8):1933-40.
  • Ge H, et al. (1994) Purification, cloning, and characterization of a human coactivator, PC4, that mediates transcriptional activation of class II genes. Cell. 78(3):513-23.
  • Kaiser K, et al. (1994) A novel mediator of class II gene transcription with homology to viral immediate-early transcriptional regulators. Cell. 78(3):525-34.
  • Size / Price
    Catálogo: HG14326-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"