After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human STX8 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC009713
Tamanho de cDNA:711bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens syntaxin 8.
Sinónimo de gene:CARB, STX8
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14243-ACG$225
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14243-ACR$225
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14243-ANG$225
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14243-ANR$225
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14243-CF$195
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14243-CH$195
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14243-CM$195
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14243-CY$195
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14243-G$75
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14243-NF$195
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14243-NH$195
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14243-NM$195
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14243-NY$195
Humano STX8 / Syntaxin 8 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14243-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

STX8, also known as syntaxin 8, directly interacts with HECTd3. STX8 forms the SNARE complex with syntaxin 7, vti1b and endobrevin. STX8 belongs to the syntaxin family. Members of this family are key molecules implicated in diverse vesicle docking and membrane fusion events. STX8 physically interacts with cystic fibrosis transmembrane conductance regulator (CFTR): recombinant syntaxin 8 binds CFTR in vitro and both proteins co-immunoprecipitate in HT29 cells. Syntaxin 8 regulates CFTR-mediated currents in chinese hamster ovary (CHO) cells stably expressing CFTR and syntaxin 8. STX8 contributes to the regulation of CFTR trafficking and chloride channel activity by the SNARE machinery.

Referências
  • Steegmaier M. et al., 1999, J Biol Chem. 273 (51): 34171-9.
  • Thoreau V. et al., 1999, Biochem Biophys Res Commun. 257 (2): 577-83.
  • Zhang L. et al., 2009, Cell Mol Neurobiol. 29 (1): 115-21.
  • Bilan F. et al., 2004, J Cell Sci. 117 (10): 1923-35.
  • Size / Price
    Catálogo: HG14243-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"