Encomenda rápida

Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human STX3 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:870bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens syntaxin 3 with N terminal HA tag.
Sinónimo de gene:STX3A
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14625-ACG$225
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14625-ACR$225
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14625-ANG$225
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14625-CF$195
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14625-CH$195
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14625-CM$195
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14625-CY$195
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14625-G$75
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14625-NF$195
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14625-NH$195
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14625-NM$195
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14625-NY$195
Humano STX3 / Syntaxin 3 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14625-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

STX3, also known as syntaxin 3, belongs to the syntaxin family. STX3 is a target membrane protein (t-SNARE) which is needed for membrane fusion. Membrane fusion requires the formation of a complex between a vesicle protein (v-SNARE) and t-SNAREs. STX3, together with syntaxin 2, are predominantly localized at the plasma membrane. Syntaxin 2 cycles between the plasma membrane and the perinuclear compartment whereas syntaxin 3 cycles between the plasma membrane and the trans-Golgi network. It is possible that this cycling has an important role in the regulation of t-SNARE function.

  • Ibaraki K. et al., 1995, Biochem Biophys Res Commun. 211 (3): 997-1005
  • Martín-Martín B. et al., 1999, J Leukoc Biol. 65 (3): 397-406.
  • Darios F. et al., 2006, Nature. 440 (7085): 813-7.
  • Size / Price
    Catálogo: HG14625-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.