Encomenda rápida

Text Size:AAA

Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human SRC Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1611bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) with N terminal His tag.
Sinónimo de gene:ASV, SRC1, c-SRC, p60-Src, SRC
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10755-ACG$245
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10755-ACR$245
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10755-ANG$245
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10755-ANR$245
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10755-CF$215
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10755-CH$215
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10755-CM$215
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10755-CY$215
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de expressão)HG10755-M$75
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10755-NF$215
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10755-NH$215
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10755-NM$215
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10755-NY$215
Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10755-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • Size / Price
    Catálogo: HG10755-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.