Encomenda rápida

Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano SRC Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_005417.3
    Tamanho de cDNA:1611bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) with N terminal His tag.
    Sinónimo de gene:ASV, SRC1, c-SRC, p60-Src, SRC
    Espécie:Human
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SRC qPCR primers for gene expression analysis, HP100685 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10755-ACG$245
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10755-ACR$245
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10755-ANG$245
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10755-ANR$245
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10755-CF$215
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10755-CH$215
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10755-CM$215
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10755-CY$215
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de expressão)HG10755-M$75
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10755-NF$215
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10755-NH$215
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10755-NM$215
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10755-NY$215
    Humano SRC/Proto-oncogene c-Src clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10755-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

    Referências
  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"