Encomenda rápida

Humano SOD2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human SOD2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:669bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens superoxide dismutase 2, mitochondrial with C terminal HA tag.
Sinónimo de gene:SOD2
Local de restrição:KpnI + XbaI (6kb + 0.71kb)
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human SOD2 Gene Plasmid Map
Human SOD2 natural ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano SOD2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Product nameProduct name

Superoxide dismutases (SOD) are important anti-oxidant enzymes that guard against superoxide toxicity. In humans, as in all mammals and most chordates, three forms of superoxide dismutase (SOD) are present: SOD1 is located in the cytoplasm, SOD2 in the mitochondria, and SOD3 is extracellular. Mitochondrial superoxide dismutase [SOD; manganese SOD (MnSOD) or SOD2] neutralizes highly reactive superoxide radical (O(

  • Culotta VC, et al. (2006) Activation of superoxide dismutases: putting the metal to the pedal. Biochim Biophys Acta. 1763(7): 747-58.
  • Bag A, et al. (2008) Target sequence polymorphism of human manganese superoxide dismutase gene and its association with cancer risk: a review. Cancer Epidemiol Biomarkers Prev. 17(12): 3298-305.
  • Diehl C, et al. (2009) The basis of topical superoxide dismutase antipruritic activity. Acta Dermatovenerol Croat. 17(1): 25-39.
  • Ma X, et al. (2010) No association between SOD2 Val16Ala polymorphism and breast cancer susceptibility: a meta-analysis based on 9,710 cases and 11,041 controls. Breast Cancer Res Treat. 122(2): 509-14.
  • Size / Price
    Catálogo: HG12061-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    • Human SOD2 natural ORF mammalian expression plasmid, C-HA tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.