After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human SNCB Informações sobre o produto de clone de cDNA
Tamanho de cDNA:405bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens synuclein, beta with N terminal His tag.
Sinónimo de gene:SNCB
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11386-ACG$225
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11386-ACR$225
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11386-ANG$225
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11386-ANR$225
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11386-CF$195
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11386-CH$195
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11386-CM$195
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11386-CY$195
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de expressão)HG11386-M$75
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11386-M-F$195
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11386-NF$195
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11386-NH$195
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11386-NM$195
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11386-NY$195
Humano SNCB clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11386-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG11386-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.