After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human SNAI2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_003068.3
Tamanho de cDNA:807bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens snail homolog 2 (Drosophila).
Sinónimo de gene:SLUG, WS2D, SLUGH1, MGC10182, SNAI2
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-SNAI2
Local de restrição:KpnI + NotI (6.1kb + 0.81kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human SNAI2 Gene Plasmid Map
Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11196-ACG$225
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11196-ACR$225
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11196-ANG$225
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11196-ANR$225
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11196-CF$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11196-CH$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11196-CM$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11196-CY$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de expressão)HG11196-M$75
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11196-M-F$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11196-NF$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11196-NH$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11196-NM$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11196-NY$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11196-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG11196-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
  • Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"