Encomenda rápida

Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem)

  • Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano SNAI2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_003068.3
Tamanho de cDNA:807bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens snail homolog 2 (Drosophila).
Sinónimo de gene:SLUG, WS2D, SLUGH1, MGC10182, SNAI2
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-SNAI2
Local de restrição:KpnI + NotI (6.1kb + 0.81kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SNAI2 qPCR primers for gene expression analysis, HP101101 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano SNAI2 Gene Plasmid Map
Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11196-ACG$225
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11196-ACR$225
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11196-ANG$225
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11196-ANR$225
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11196-CF$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11196-CH$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11196-CM$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11196-CY$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de expressão)HG11196-M$75
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11196-M-F$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11196-NF$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11196-NH$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11196-NM$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11196-NY$195
Humano SNAI2 / Snail2 / slug clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11196-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG11196-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"