Encomenda rápida

Text Size:AAA

Humano Neuroserpin/SerpinI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human SERPINI1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1233bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade I (neuroserpin), member 1 with C terminal His tag.
Sinónimo de gene:PI12, neuroserpin, DKFZp781N13156
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Neuroserpin/SerpinI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Product nameProduct name

Neuroserpin, also known as Protease inhibitor 12 and SERPINI1, is a secreted protein which belongs to the serpin family. Neuroserpin is a serine protease inhibitor that inhibits plasminogen activators and plasmin but not thrombin. Serine protease inhibitors of the serpin superfamily are involved in many cellular processes. Neuroserpin was first identified as a protein secreted from the axons of dorsal root ganglion neurons. Neuroserpin is predominantly expressed in the brain, and is expressed in the late stages of neurogenesis during the process of synapse formation. Overexpression of neuroserpin in an anterior pituitary corticotroph cell line results in the extension of neurite-like processes, suggesting that neuroserpin may play a role in cell communication, cell adhesion, and/or cell migration. Neuroserpin may be involved in the formation or reorganization of synaptic connections, as well as synaptic plasticity in the adult nervous system. Neuroserpin may also protect neurons from cell damage by tissue-type plasminogen activator. Defects of neuroserpin are the cause of familial encephalopathy with neuroserpin inclusion bodies (FEN1B).

  • Schrimpf SP. et al., 1997, Genomics. 40 (1): 55-62.
  • Hill RM. et al., 2002, Ann N Y Acad Sci. 971: 406-15.
  • Yepes M. et al., 2004, Thromb. Haemost. 91 (3): 457-64.
  • Galliciotti G. et al., 2006, Front Biosci. 11: 33-45.
  • Size / Price
    Catálogo: HG11107-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.