After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano PEDF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human SERPINF1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_002615.4
Tamanho de cDNA:1257bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1 with C terminal His tag.
Sinónimo de gene:PEDF, EPC-1, PIG35
Espécie:Human
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fundo

Pigment epithelium-derived factor, also known as PEDF, Serpin F1, and SERPINF1, is a multiple functional protein which has both anti-angiogenic activity and neurotrophic activity at the same time. PEDF is a secreted glycoprotein that belongs to the noninhibitory serpin. It has an alpha/beta core serine-protease inhibitor domain, three major beta-sheets, and ten alpha-helices. PEDF does not inhibit either serine or cysteine proteinases. PEDF exerts diverse physiological activities including anti-angiogenesis, anti-vasopermeability, anti-tumor, and neurotrophic activities. PEDF acts via multiple high affinity ligands and cell receptors. It has been described as a natural angiogenesis inhibitor with neurotrophic and immune-modulation properties. PEDF induces macrophages apoptosis and necrosis through the activation of peroxisome proliferator-activated receptor-gamma by which PEDF could modulate inflammatory reactions in septic shock. It balances angiogenesis in the eye and blocks tumor progression.

Referências
  • Ren, JG. et al., 2005, Med Hypotheses. 64 (1): 74-8.
  • Filleur, S. et al., 2009. J Cell Biochem. 106 (5): 769-75.
  • Kawaguchi, T. et al., 2010, Curr Mol Med. 10 (3): 302-11.
  • Yamagishi, SI. et al., 2010, Curr Mol Med. 10 (3): 284-91.
  • Nakamura, T. et al., 2010, Curr Mol Med. 10 (3): 312-6.
  • Size / Price
    Catálogo: HG11104-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"