After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano SEMA6A clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human SEMA6A Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_020796.3
Tamanho de cDNA:3093bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A.
Sinónimo de gene:VIA, SEMA, HT018, SEMAQ, SEMA6A1, KIAA1368, SEMA6A
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-SEMA6A
Local de restrição:KpnI + NotI (6.1kb + 3.09kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human SEMA6A Gene Plasmid Map
Human SEMA6A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Referências
  • Klostermann A., et al., 2000, J. Biol. Chem. 275:39647-53.
  • Nagase T., et al., 2000, DNA Res. 7:65-73.
  • Schmutz J., et al., 2004, Nature 431:268-74.
  • Neufeld, G. et al., 2005, Front Biosci. 10 : 751-60.
  • Fiore,R. et al., 2005, Mol Cell Biol. 25 (6):2310-9.
  • Size / Price
    Catálogo: HG11189-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human SEMA6A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"