After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human SEMA3A Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_006080.2
Tamanho de cDNA:2316bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A with N terminal His tag.
Sinónimo de gene:SemD, SEMA1, SEMAD, SEMAL, coll-1, Hsema-I, SEMAIII, Hsema-III, MGC133243, SEMA3A
Espécie:Human
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10758-ACG$245
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10758-ACR$245
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10758-CF$215
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10758-CH$215
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10758-CM$215
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10758-CY$215
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de expressão)HG10758-M$75
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10758-M-N$215
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10758-NF$215
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10758-NH$215
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10758-NM$215
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10758-NY$215
Humano Semaphorin 3A/SEMA3A clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10758-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Semaphorins are a family of secreted and cell-bound signaling molecules defined by the presence of a common 500 aa Sema domain. They are best characterized in relation to axon guidance during development of the nervous system. The functions of Semaphorins 3A (SEMA3A) are mediated primarily through binding to the Neuropilin-1 (Npn-1) and Plexin-A1 coreceptor complex. Neuropilins lack a signaling-competent cytoplasetmic domain and ensure semaphorin binding, whereas the transmembrane receptor plexin mediates the intracellular response. As the first identified vertebrate semaphorin, SEMA3A functions either as a chemorepulsive agent inhibiting axonal outgrowth, or as a chemoattractive agent stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Its overexpression is associated with schizophrenia which is seen in various human tumor cell lines, and aberrant release is associated with the progression of Alzheimer's disease

Referências
  • Giordano,A. et al., 2003, J Neurocytol.32(4):345-352.
  • Good, P. F. et al., 2005, J. Neurochem.91(3): 716-736.
  • Gu, C. et al., 2005, Science.307(5707): 265–268.
  • Chadborn,N.H. et al., 2006, J Cell Sci.119(Pt 5):951-957.
  • Schmidt,E.F. et al., 2007, Adv Exp Med Biol.600:1-11.
  • Size / Price
    Catálogo: HG10758-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"