Syntenin cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15640-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Syntenin Reagents

CRO Services

Product recommended


All Syntenin Reagents

Syntenin cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Human syndecan binding protein (syntenin) with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Syntenin cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

MDA-9 cDNA ORF Clone, Human;MDA9 cDNA ORF Clone, Human;ST1 cDNA ORF Clone, Human;SYCL cDNA ORF Clone, Human;TACIP18 cDNA ORF Clone, Human

Syntenin Background Information

Syntenin1/SDCBP (syndecan binding protein), also known as melanoma differentiation associated gene-9 (MDA-9), is a PDZ domain-containing molecule, which was initially identified as a key oncogene in melanoma. IL-6 promotes glioma cell proliferation and invasion by inducing SDCBP expression, which is mediated by JAK2/STAT3 signaling. SDCBP might be an important marker for identifying Triple negative breast cancer (TNBC) cases that are suitable for dasatinib therapy.
Full Name
syndecan binding protein (syntenin)

Syntenin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Syntenin cDNA ORF Clone in Cloning Vector, Rat RG83597-U
Syntenin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83597-ACGLN

Syntenin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Syntenin cDNA ORF Clone in Cloning Vector, Mouse MG52262-G
Syntenin cDNA ORF Clone, Mouse, untagged MG52262-UT
Syntenin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52262-ACG
Syntenin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52262-ACGLN
Syntenin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52262-ANG
Syntenin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52262-ACR
Syntenin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52262-ANR
Syntenin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52262-CF
Syntenin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52262-NF
Syntenin cDNA ORF Clone, Mouse, C-His tag MG52262-CH
Syntenin cDNA ORF Clone, Mouse, N-His tag MG52262-NH
Syntenin cDNA ORF Clone, Mouse, C-HA tag MG52262-CY
Syntenin cDNA ORF Clone, Mouse, N-HA tag MG52262-NY
Syntenin cDNA ORF Clone, Mouse, C-Myc tag MG52262-CM
Syntenin cDNA ORF Clone, Mouse, N-Myc tag MG52262-NM
Syntenin qPCR Primer Pairs, Mouse MP202135

Syntenin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Syntenin cDNA ORF Clone in Cloning Vector, Human HG15640-G
Syntenin cDNA ORF Clone, Human, untagged HG15640-UT
Syntenin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15640-ACGLN
Syntenin cDNA ORF Clone, Human, C-GFPSpark® tag HG15640-ACG
Syntenin cDNA ORF Clone, Human, N-GFPSpark® tag HG15640-ANG
Syntenin cDNA ORF Clone, Human, C-OFPSpark® tag HG15640-ACR
Syntenin cDNA ORF Clone, Human, N-OFPSpark® tag HG15640-ANR
Syntenin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15640-NF
Syntenin cDNA ORF Clone, Human, C-His tag HG15640-CH
Syntenin cDNA ORF Clone, Human, N-His tag HG15640-NH
Syntenin cDNA ORF Clone, Human, C-HA tag HG15640-CY
Syntenin cDNA ORF Clone, Human, N-HA tag HG15640-NY
Syntenin cDNA ORF Clone, Human, C-Myc tag HG15640-CM
Syntenin cDNA ORF Clone, Human, N-Myc tag HG15640-NM
Syntenin qPCR Primer Pairs, Human HP104258
info info
添加购物车成功! 添加购物车失败!