Encomenda rápida

Text Size:AAA

Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human SCLY Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1338bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens selenocysteine lyase with N terminal Myc tag.
Sinónimo de gene:SCL, hSCL
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14905-ACG$225
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14905-ACR$225
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14905-ANG$225
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14905-ANR$225
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14905-CF$195
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14905-CH$195
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14905-CM$195
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14905-CY$195
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de expressão)HG14905-G$75
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14905-NF$195
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14905-NH$195
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14905-NM$195
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14905-NY$195
Humano SCLY / Selenocysteine Lyase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14905-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

SCLY, also known as selenocysteine lyase, belongs to the class-V pyridoxal-phosphate-dependent aminotransferase family. It is a novel enzyme that exclusively decomposes L-selenocysteine into L-alanine and H2Se in various mammalian tissues. SCLY contains pyridoxal 5'-phosphate and weighs approximately 85,000. SCLY participates in selenoamino acid metabolism. It employs one cofactor, pyridoxal phosphate. Its maximum reactivity is at about pH 9.0. It was shown that 1 mol of selenocysteine is converted to equimolar amounts of alanine and H2Se. The following amino acids are insert: L-cysteine, L-serine, L-cysteine sulfinate, selenocysteamine, Se-ethyl-DL-selenocysteine, and L-selenohomocysteine. L-Cysteine (Ki, 1.0 mM) competes with L-selenocysteine (Km, 0.83mM) to inhibit the enzyme reaction.

  • Johansson AL. et al., 2012, PLoS One. 7 (1): e30528.
  • Collins R. et al., 2012, PLoS One. 7 (1): e30581.
  • N Esaki. et al., 1982, The Journal of Biological Chemistry. 257: 4386-91.
  • Size / Price
    Catálogo: HG14905-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.