Encomenda rápida

Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano RPS6KB1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_003161.2
    Tamanho de cDNA:1578bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 with N terminal His tag.
    Sinónimo de gene:RPS6KB1, S6K, PS6K, S6K1, STK14A, p70-S6K, p70-alpha, p70(S6K)-alpha
    Espécie:Human
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RPS6KB1 qPCR primers for gene expression analysis, HP100180 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10099-ACG$245
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10099-ACR$245
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10099-ANG$245
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10099-ANR$245
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10099-CF$215
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10099-CH$215
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10099-CM$215
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10099-CY$215
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10099-M$75
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10099-NF$215
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10099-NH$215
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10099-NM$215
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10099-NY$215
    Humano PS6K / RPS6KB1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10099-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    PS6K, also known as RPS6KB1, is a serine/threonine-protein kinase. It belongs to the RSK (ribosomal s6 kinase) family. Members of this family function in signal transduction. PS6K is an isoform of p70 ribosomal S6 kinase (S6K). S6K can be activated by mitogenic stimuli such as growth factors, insulin and cytokines. It phosphorylates the ribosomal protein S6. PS6K also phosphorylates other proteins such as elF4B, eEF2K and SKAR. It is a crucial effector of mTOR(rapamycin) signaling. PS6K is dissociated from the EIF3 complex and activated upon mitogenic stimulation, phosphorylation by the mammalian target of mTOR complex 1 (mTORC1). Its active form then phosphorylates and activates several substrates in the preinitiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. PS6K also functions in cell proliferation, cell growth and cell cycle progression.

    Referências
  • Panasyuk, et al. (2006) Nuclear export of PS6K II is regulated by protein kinase CK2 phosphorylation at Ser-17. J Biol Chem. 281(42):31188-201.
  • Carnevalli L, et al. (2010) PS6K Plays a Critical Role in Early Adipocyte Differentiation. Dev Cell. 18 (5):763-74.
  • Grove JR, et al. (1991) Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol Cell Biol. 11(11):5541-50.
  • Size / Price
    Catálogo: HG10099-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"