Encomenda rápida

Text Size:AAA

Humano S100A9/MRP-14 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human S100A9 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:345bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens S100 calcium binding protein A9 with C terminal HA tag.
Sinónimo de gene:MIF, NIF, P14, CAGB, CFAG, CGLB, L1AG, LIAG, MRP14, 60B8AG, MAC387, S100A9
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano S100A9/MRP-14 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Product nameProduct name

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. Protein S100-A9, also known as S100 calcium-binding protein A9, S100A9, and CAGB, is a member of the S-100 family. S100A9 is expressed by macrophages in acutely inflammed tissues and in chronic inflammation. It is also expressed in epithelial cells constitutively or induced during dermatoses. S100A9 is a calcium-binding protein. It has anti-microbial activity towards bacteria and fungi. The anti-microbial and proapoptotic activity of S100A9 is inhibited by zinc ions. S100A9 plays a role in the development of endotoxic shock in response to bacterial lipopolysaccharide (LPS). It promotes tubulin polymerization when unphosphorylated. It also promotes phagocyte migration and infiltration of granulocytes at sites of wounding. S100A9 plays a role as a pro-inflammatory mediator in acute and chronic inflammation and up-regulates the release of IL8 and cell-surface expression of ICAM1.

  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Fanò G. et al., 1995, Prog Neurobiol. 46 (1): 71-82.
  • Vogl T. et al., 2004, Blood. 104: 4260-8.
  • Viemann D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani Y. et al., 2005, Mediators Inflamm. 2005: 280-92.
  • Bjoerk P. et al., 2009, PLoS Biol. 7: E97-E97.
  • Size / Price
    Catálogo: HG11145-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.