After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human S100A7 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_002963.3
Tamanho de cDNA:306bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens S100 calcium binding protein A7 with C terminal HA tag.
Sinónimo de gene:PSOR1, S100A7c, S100A7
Espécie:Human
Vetor:pCMV3-C-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11141-ACG$225
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11141-ACR$225
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11141-ANG$225
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11141-ANR$225
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11141-CF$195
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11141-CH$195
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11141-CM$195
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11141-CY$195
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11141-M$75
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11141-M-F$195
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11141-NF$195
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11141-NH$195
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11141-NM$195
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11141-NY$195
Humano S100A7 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11141-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Protein S100-A7, also known as S100 calcium-binding protein A7, Psoriasin, S100A7, and PSOR1, is a secreted protein which belongs to the S-100 family. S100A7 was first isolated from skin involved by psoriasis, which can be induced in cultured squamous epithelial cells. S100A7 is expressed by both normal cultured and malignant keratinocytes and malignant breast epithelial cells within ductal carcinoma in situ, suggesting an association with abnormal pathways of differentiation. S100A7 plays a role in the pathogenesis of inflammatory skin disease, as a chemotactic factor for hematopoietic cells. It also plays a role in early stages of breast tumor progression in association with the development of the invasive phenotype.

Referências
  • Miyasaki, KT. et al., 1993, J. Dent. Res. 72: 517-23.
  • Watson, PH. et al., 1998, Int J Biochem Cell Biol  30 (5):567-71.
  • Emberley, ED. et al., 2004, Breast Cancer Res  6 (4): 153-9.
  • Ohuchida, K. et al., 2006, Clin Cancer Res  12 (18):5417-22.
  • Kouno, T. et al., 2008, J Pept Sci. 14 (10):1129-38.
  • León, R. et al., 2009, Biochemistry. 48 (44): 10591-600.
  • Size / Price
    Catálogo: HG11141-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"