Encomenda rápida

Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano S100A11 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_005620.1
    Tamanho de cDNA:318bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens S100 calcium binding protein A11 with C terminal HA tag.
    Sinónimo de gene:MLN70, S100C, S100A11
    Espécie:Human
    Vetor:pCMV3-C-HA
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with S100A11 qPCR primers for gene expression analysis, HP101050 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11140-ACG$225
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11140-ACR$225
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11140-ANG$225
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11140-ANR$225
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11140-CF$195
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11140-CH$195
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11140-CM$195
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11140-CY$195
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de expressão)HG11140-M$75
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11140-M-F$195
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11140-NF$195
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11140-NH$195
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11140-NM$195
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11140-NY$195
    Humano S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11140-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Protein S100-A11, also known as S100 calcium-binding protein A11, S100A11 and MLN70, is a member of the S-100 family. S100A11 is widely expressed in multiple tissues, and is located in cytoplasm, nucleus, and even cell periphery. S100A11 exists as a non-covalent homodimer with an antiparallel conformation. Ca(2+) binding to S100A11 would trigger conformational changes which would expose the hydrophobic cleft of S100A11 and facilitate its interaction with target proteins. As a dual cell growth mediator, S100A11 acts as either a tumor suppressor or promoter in many different types of tumors and would play respective roles in influencing the proliferation of the cancer cells. In the nucleus, S100A11 suppresses the growth of keratinocytes through p21 (CIP1/WAF1) activation and induces cell differentiation. S100A11 is also a novel diagnostic marker in breast carcinoma.

    Referências
  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Ohuchida K. et al., 2006, Clin Cancer Res  12 (18): 5417-22.
  • Kouno T. et al., 2008, J Pept Sci. 14 (10): 1129-38.
  • He H. et al., 2009, Cell Biochem Biophys 55 (3): 117-26.
  • Liu XG. et al., 2010, Oncol Rep. 23 (5): 1301-8.
  • Size / Price
    Catálogo: HG11140-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"