After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano RSPO3 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human RSPO3 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_032784.3
Tamanho de cDNA:819bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens R-spondin 3 homolog (Xenopus laevis).
Sinónimo de gene:PWTSR, THSD2, CRISTIN1, FLJ14440, RSPO3
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-RSPO3
Local de restrição:KpnI + XbaI (6.1kb + 0.82kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutation 567 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fundo

R-spondin 3 (RSPO3) is a member of the R-Spondin (RSPO) family in vertebrates that activate Wnt/beta-catenin signaling, plays a key role in these processes. The RSPO family of secreted Wnt modulators is involved in development and disease and holds therapeutic promise as stem cell growth factors. The four members have high structural homology. RSPO2 and RSPO3 are more potent than RSPO1, whereas RSPO4 is relatively inactive. All RSPO members require Wnt ligands and LRP6 for activity and amplify signaling of Wnt3A, Wnt1, and Wnt7A, suggesting that RSPO proteins are general regulators of canonical Wnt signaling. RSPO3/PCP signaling during gastrulation requires Wnt5a and is transduced via Fz7, Dvl, and JNK. RSPO3 functions by inducing Sdc4-dependent, clathrin-mediated endocytosis. RSPO3 is a novel, evolutionarily conserved angiogenic factor in embryogenesis. RSPO3 has a key role in the interaction between chorion and allantois in labyrinthine development.

Referências
  • Aoki M, et al. (2007) R-spondin3 is required for mouse placental development. Dev Biol. 301(1): 218-26.
  • Kazanskaya O, et al. (2008) The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development. Development. 135(22): 3655-64.
  • Kim KA, et al. (2008) R-Spondin family members regulate the Wnt pathway by a common mechanism. Mol Biol Cell. 19(6): 2588-96.
  • Ohkawara B, et al. (2011) Rspo3 Binds Syndecan 4 and Induces Wnt/PCP Signaling via Clathrin-Mediated Endocytosis to Promote Morphogenesis. Dev Cell. 20(3): 303-14.
  • Size / Price
    Catálogo: HG11185-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"