Encomenda rápida

Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human RGS7 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1464bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens regulator of G-protein signaling 7 with N terminal His tag.
Sinónimo de gene:RGS7
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14859-ACG$225
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14859-ACR$225
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14859-ANG$225
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14859-ANR$225
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14859-CF$215
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14859-CH$195
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14859-CM$195
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14859-CY$195
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14859-G$75
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14859-G-Y$195
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14859-NF$195
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14859-NH$195
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14859-NM$195
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14859-NY$195
Humano RGS7 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14859-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG14859-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.