Encomenda rápida

Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

  • Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano RELA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1656bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal His tag.
Sinónimo de gene:p65
Local de restrição:KpnI + XbaI (6kb + 1.7kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
( We provide with RELA qPCR primers for gene expression analysis, HP100039 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano RELA Gene Plasmid Map
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12054-ACG$245
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12054-ACR$245
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12054-ANG$245
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12054-ANR$245
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12054-CF$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12054-CH$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12054-CM$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12054-CY$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de expressão)HG12054-G$75
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12054-NF$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12054-NH$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12054-NM$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12054-NY$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12054-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

  • Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.
  • Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.
  • Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.
  • Size / Price
    Catálogo: HG12054-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.