After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human RELA Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_021975
Tamanho de cDNA:1656bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal His tag.
Sinónimo de gene:p65
Espécie:Human
Vetor:pCMV3-C-His
Plasmid:pCMV3-RELA-His
Local de restrição:KpnI + XbaI (6kb + 1.7kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human RELA Gene Plasmid Map
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12054-ACG$245
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12054-ACR$245
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12054-ANG$245
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12054-ANR$245
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12054-CF$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12054-CH$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12054-CM$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12054-CY$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de expressão)HG12054-G$75
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12054-NF$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12054-NH$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12054-NM$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12054-NY$215
Humano RELA / Transcription factor p65 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12054-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

Referências
  • Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.
  • Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.
  • Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.
  • Size / Price
    Catálogo: HG12054-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"