Encomenda rápida

Humano RAET1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano RAET1L Informações sobre o produto de clone de cDNA
Tamanho de cDNA:741bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens retinoic acid early transcript 1L with C terminal His tag.
Sinónimo de gene:ULBP6
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
( We provide with RAET1L qPCR primers for gene expression analysis, HP104351 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catálogo: HG15759-CH
Preço de catálogo: 
Preço:      (You Save: )
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.