Encomenda rápida

Humano RAB5A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

  • Human RAB5A ORF mammalian expression plasmid, C-His tag
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano RAB5A Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC001267
Tamanho de cDNA:648bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens RAB5A, member RAS oncogene family with C terminal His tag.
Sinónimo de gene:RAB5, RAB5A
Espécie:Human
Vetor:pCMV3-C-His
Plasmid:pCMV3-Rab5-His
Local de restrição:KpnI + XbaI (6kb + 0.69kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RAB5A qPCR primers for gene expression analysis, HP102669 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano RAB5A Gene Plasmid Map
Human RAB5A ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano RAB5A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Product nameProduct name
Size / Price
Catálogo: HG14013-CH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"