Encomenda rápida

Humano Glutaminyl cyclase / QPCT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano QPCT Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC047756
    Tamanho de cDNA:1086bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens glutaminyl-peptide cyclotransferase with N terminal Myc tag.
    Sinónimo de gene:GCT, QC, sQC, QPCT
    Espécie:Human
    Vetor:pCMV3-SP-N-Myc
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with QPCT qPCR primers for gene expression analysis, HP102429 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano Glutaminyl cyclase / QPCT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
    Product nameProduct name
    Fundo

    Glutaminyl cyclase, also known as QPCT, can promote the N-terminal cyclization reaction of N-terminal pyroglutamate(pGlu). The pGlu formation from its glutaminyl precursor is required in the maturation of numerous bioactive peptides, while the aberrant formation of pGlu may be related to several pathological processes, such as osteoporosis and amyloidotic diseases. Glutaminyl cyclase's structure reveals an alpha/beta scaffold akin to that of two-zinc exopeptidases but with several insertions and deletions, particularly in the active-site region. Glutaminyl cyclase's amino acid sequence of this enzyme is 86% identical to that of bovine glutaminyl cyclase. It is responsible for the presence of pyroglutamyl residues in many neuroendocrine peptides.

    Referências
  • Busby WH, et al. (1987) An enzyme(s) that converts glutaminyl-peptides into pyroglutamyl-peptides. Presence in pituitary, brain, adrenal medulla, and lymphocytes. J Biol Chem. 262(18):8532-6.
  • Bateman RC, et al. (2001) Evidence for essential histidines in human pituitary glutaminyl cyclase. Biochemistry. 40(37):11246-50.
  • Schilling S, et al. (2002) Heterologous expression and characterization of human glutaminyl cyclase: evidence for a disulfide bond with importance for catalytic activity. Biochemistry. 41 (35):10849-57.
  • Size / Price
    Catálogo: HG13752-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"