After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PTGS2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_000963
Tamanho de cDNA:1815bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) with C terminal His tag.
Sinónimo de gene:COX2
Espécie:Human
Vetor:pCMV3-C-His
Plasmid:pCMV3-PTGS2-His
Local de restrição:KpnI + XbaI (6kb + 1.86kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human PTGS2 Gene Plasmid Map
Human PTGS2 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12036-ACG$245
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12036-ACR$245
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12036-ANG$245
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12036-ANR$245
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12036-CF$215
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12036-CH$215
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12036-CM$215
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12036-CY$215
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG12036-G$75
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12036-NF$215
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12036-NH$215
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12036-NM$215
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12036-NY$215
Humano COX-2/PTGS2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12036-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

PTGS2, also known as COX-2, is s component of Prostaglandin-endoperoxide synthase (PTGS). PTGS, also known as cyclooxygenase, is the key enzyme in prostaglandin biosynthesis, and acts both as a dioxygenase and as a peroxidase. There are two isozymes of PTGS: a constitutive PTGS1 and an inducible PTGS2, which differ in their regulation of expression and tissue distribution. PTGS2 is over expressed in many cancers. The overexpression of PTGS2 along with increased angiogenesis and GLUT-1 expression is significantly associated with gallbladder carcinomas. Furthermore the product of COX-2, PGH2 is converted by prostaglandin E2 synthase into PGE2, which in turn can stimulate cancer progression. Consequently inhibiting COX-2 may have benefit in the prevention and treatment of these types of cancer. PTGS2 is regulated by specific stimulatory events, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. It mediates the formation of prostaglandins from arachidonate and may have a role as a major mediator of inflammation and/or a role for prostanoid signaling in activity-dependent plasticity.

Referências
  • Picot, et al. (1994) The X-ray crystal structure of the membrane protein prostaglandin H2 synthase-1. Nature. 367(6460):243-9.
  • Xie W, et al. (1991) Expression of a Mitogen-Responsive Gene Encoding Prostaglandin Synthase is Regulated by mRNA Splicing. Proceedings of the National Academy of Sciences. 88(7):2692-6.
  • Hla T, et al. (1992) Human Cyclooxygenase-2 cDNA. Proceedings of the National Academy of Sciences. 89(16):7384-8.
  • Size / Price
    Catálogo: HG12036-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human PTGS2 ORF mammalian expression plasmid, C-His tag
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"