Encomenda rápida

Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano PSME2 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC004368
    Tamanho de cDNA:720bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens proteasome (prosome, macropain) activator subunit 2 (PA28 beta) with N terminal HA tag.
    Sinónimo de gene:PA28B, REGbeta, PA28beta
    Espécie:Human
    Vetor:pCMV3-N-HA
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PSME2 qPCR primers for gene expression analysis, HP103274 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14640-ACG$225
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14640-ACR$225
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14640-ANG$225
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14640-ANR$225
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14640-CF$195
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14640-CH$195
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14640-CM$195
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14640-CY$195
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de expressão)HG14640-G$75
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14640-NF$195
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14640-NH$195
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14640-NM$195
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14640-NY$195
    Humano PSME2 / PA28b clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14640-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    PSME2, also known as PA28b, is a subunit of proteasome. The 26S proteasome multicatalytic proteinase complex has a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. PSME2 gene encodes the beta subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three beta and three alpha subunits combine to form a heterohexameric ring.

    Referências
  • Ahn K. et al., 1996, J Biol Chem. 271 (30): 18237-42.
  • Rual Jean-François. et al., 2005, Nature. 437 (7062): 1173-8.
  • Ahn JY. et al., 1995, FEBS Lett. 366 (1): 37-42.
  • Size / Price
    Catálogo: HG14640-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"