Encomenda rápida

Humano PSMB8 clonagem de ADN ou de clonagem do gene (vector de clonagem)

  • Human PSMB8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano PSMB8 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_004159.4
Tamanho de cDNA:819bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7).
Sinónimo de gene:LMP7, D6S216, PSMB5i, RING10, D6S216E, MGC1491, PSMB8
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-PSMB8
Local de restrição:KpnI + XbaI (6.1kb + 0.82kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PSMB8 qPCR primers for gene expression analysis, HP101564 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano PSMB8 Gene Plasmid Map
Human PSMB8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano PSMB8 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Product nameProduct name
Size / Price
Catálogo: HG12028-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Itens recentemente visualizados
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"