After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PRKCB Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_002738.6
Tamanho de cDNA:2022bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens protein kinase C, beta with N terminal His tag.
Sinónimo de gene:PKCB, PRKCB1, PRKCB2, MGC41878, PKC-beta, PRKCB
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10750-ACG$245
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10750-ACR$245
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10750-ANG$245
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10750-ANR$245
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10750-CF$215
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10750-CH$215
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10750-CM$215
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10750-CY$215
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10750-NF$215
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10750-NH$215
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10750-NM$215
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10750-NY$215
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de expressão)HG10750-U$75
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10750-U-F$215
Humano PRKCB clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10750-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG10750-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"