Encomenda rápida

Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano PRICKLE2 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:2535bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens prickle homolog 2 (Drosophila) with N terminal His tag.
    Sinónimo de gene:EPM5
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    ( We provide with PRICKLE2 qPCR primers for gene expression analysis, HP104552 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15965-ACG$325
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15965-ACR$325
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG15965-ANG$325
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG15965-ANR$325
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15965-CF$295
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15965-CH$295
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15965-CM$295
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15965-CY$295
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG15965-G$75
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15965-NF$295
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15965-NH$295
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15965-NM$295
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15965-NY$295
    Humano PRICKLE2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15965-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: HG15965-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.