Encomenda rápida

Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano PREP Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2133bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens prolyl endopeptidase with C terminal Flag tag.
Sinónimo de gene:PE, PEP, MGC16060
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
( We provide with PREP qPCR primers for gene expression analysis, HP100950 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10987-ACG$245
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10987-ACR$245
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10987-ANG$245
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10987-ANR$245
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10987-CF$215
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10987-CH$215
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10987-CM$215
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10987-CY$215
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de expressão)HG10987-M$75
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10987-NF$215
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10987-NH$215
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10987-NM$215
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10987-NY$215
Humano Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10987-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Prolyl endopeptidase, also known as PREP, belongs to a distinct class of serine peptidases. It is a large cytosolic enzyme which was first described in the cytosol of rabbit brain as an oligopeptidase. Prolyl endopeptidase degrades the nonapeptide bradykinin at the Pro-Phe bond. It is involved in the maturation and degradation of peptide hormones and neuropeptides such as alpha-melanocyte-stimulating hormone, luteinizing hormone-releasing hormone (LH-RH), thyrotropin-releasing hormone, angiotensin, neurotensin, oxytocin, substance P and vasopressin. Prolyl endopeptidase's activity is confined to action on oligopeptides of less than 10 kD and it has an absolute requirement for the trans-configuration of the peptide bond preceding proline. It cleaves peptide bonds at the C-terminal side of proline residues.

  • Oliveira EB, et al. (1976) Isolation of brain endopeptidases: Influence of size and sequence of substrates structurally related to bradykinin. Biochemistry. 15(9):1967-74.
  • Stepniak D, et al. (2006) Highly efficient gluten degradation with a newly identified prolyl endoprotease: implications for celiac disease. Am J Physiol Gastrointest Liver Physiol. 291(4): G621-9.
  • Jarho EM, et al. (2007) 2(S)-(Cycloalk-1-enecarbonyl)-1-(4-phenyl-butanoyl)pyrrolidines and 2(S)-(aroyl)-1-(4-phenylbutanoyl)pyrrolidines as prolyl oligopeptidase inhibitors. Bioorg Med Chem. 15(5):2024-31.
  • Size / Price
    Catálogo: HG10987-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.