After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PRDX1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC007063.1
Tamanho de cDNA:600bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens peroxiredoxin 1.
Sinónimo de gene:PAG, PAGA, PAGB, PRX1, PRXI, MSP23, NKEFA, TDPX2, PRDX1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-PRDX1
Local de restrição:KpnI + XbaI (6.1kb + 0.6kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human PRDX1 Gene Plasmid Map
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11194-ACG$225
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11194-ACR$225
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11194-ANG$225
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11194-ANR$225
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11194-CF$195
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11194-CH$195
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11194-CM$195
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11194-CY$195
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11194-M$75
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11194-M-F$195
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11194-NF$195
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11194-NH$195
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11194-NM$195
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11194-NY$195
Humano Peroxiredoxin 1/PRDX1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11194-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

Referências
  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.
  • Size / Price
    Catálogo: HG11194-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"