Encomenda rápida

Text Size:AAA

Humano PPP3R1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PPP3R1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:513bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens protein phosphatase 3, regulatory subunit B, alpha with N terminal His tag.
Sinónimo de gene:CNB, CNB1, CALNB1, PPP3R1
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano PPP3R1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Product nameProduct name

PPP3R1 belongs to the calcineurin regulatory subunit family. It is a regulatory subunit of calcineurin. Calcineurin is composed of two subunits: calcineurin A (CnA) and calcineurin B (CnB). Dephosphorylation of the nuclear factor of activated T-cells (NF-AT) by Calcineurin is essential for NF-AT activation, nuclear translocation, and early gene expression in T-cells. PPP3R1 is a Ser/Thr-specific calcium and calmodulin-dependent protein phosphatase which takes a vital part in the T cell activation pathway. PPP3R1 is involved in protein dephosphorylation, NFAT protein import into nucleus (ortholog) and epithelial to mesenchymal transition (ortholog). It participates in calcineurin signaling pathway; mitogen activated protein kinase signaling pathway. PPP3R1 interacts with (+)-pilocarpine, 2,4-dinitrotoluene and ammonium chloride. It contains four EF-hand domains and four functional calcium-binding sites. PPP3R1 play an improtant role in the T cell activation pathway.

  • Feng B, et al. (1999) Interactions of calcineurin A, calcineurin B, and Ca2+. Biochemistry 38 (38): 12481-9.
  • Kawamura A, et al. (1995) Interaction of FKBP12-FK506 with calcineurin A at the B subunit-binding domain. J Biol Chem. 270(26):15463-6.
  • Wang MG, et al. (1997) Calcineurin A alpha (PPP3CA), calcineurin A beta (PPP3CB) and calcineurin B (PPP3R1) are located on human chromosomes 4, 10q21q22 and 2p16p15 respectively. Cytogenet Cell Genet. 72(2-3):236-41.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.