Encomenda rápida

Humano PPARG clonagem de ADN ou de clonagem do gene (vector de clonagem)

  • Human PPARG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano PPARG Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_015869.4
Tamanho de cDNA:1518bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens peroxisome proliferator-activated receptor gamma.
Sinónimo de gene:PPARG1, PPARG2, NR1C3, PPARgamma
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-PPARG
Local de restrição:KpnI + XbaI (6.1kb + 1.52kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PPARG qPCR primers for gene expression analysis, HP101555 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano PPARG Gene Plasmid Map
Human PPARG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano PPARG clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Product nameProduct name
Referências
  • Hamblin M, et al. (2009) PPARs and the Cardiovascular System. Antioxid Redox Signal. 11 (6): 1415-52.
  • Khateeb J, et al. (2010) Paraoxonase 1 (PON1) expression in hepatocytes is upregulated by pomegranate polyphenols: a role for PPAR-gamma pathway. Atherosclerosis. 208 (1): 119-25.
  • Fajas L, et al. (1997) The organization, promoter analysis, and expression of the human PPARgamma gene. J Biol Chem. 272 (30): 18779-89.
  • Size / Price
    Catálogo: HG12019-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"