PON1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13083-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All PON1 Reagents

CRO Services

Product recommended


All PON1 Reagents

PON1 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1068 bp
Description
Full length Clone DNA of Human paraoxonase 1 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PON1 cDNA ORF Clone, Human, N-Myc tag Alternative Names

MVCD5 cDNA ORF Clone, Human;PON cDNA ORF Clone, Human

PON1 Background Information

Paraoxonase 1 (PON1) is a high-density lipoprotein (HDL)-associated enzyme involved in the protection of low-density lipoprotein and HDLs against lipid peroxidation. Paraoxonase 1 (PON1) is a calcium-dependent esterase synthesized primarily in the liver and secreted into the plasma where it is associated with high-density lipoproteins (HDL). PON1 hydrolyzes and detoxifies some toxic metabolites of organophosphorus compounds (OPs) such as methyl parathion and chlorpyrifos. Thus, PON1 activity and expression levels are important for determining susceptibility against OPs poisoning.Paraoxonase 1 (PON1) is an enzyme that prevents the peroxidation of lipoprotein and cell membranes.Paraoxonase 1 (PON1) is a widely studied enzyme based on its protective role against poisoning by organophosphate (OP) metabolites of specific OP insecticides and in vascular disease, as well as its use as biomarker of diseases involving oxidative stress, inflammation and liver diseases.
Full Name
paraoxonase 1

PON1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PON1 cDNA ORF Clone in Cloning Vector, Mouse MG52381-U
PON1 cDNA ORF Clone, Mouse, untagged MG52381-UT
PON1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52381-ACGLN
PON1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52381-ACG
PON1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52381-ACR
PON1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52381-CF
PON1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52381-NF
PON1 cDNA ORF Clone, Mouse, C-His tag MG52381-CH
PON1 cDNA ORF Clone, Mouse, N-His tag MG52381-NH
PON1 cDNA ORF Clone, Mouse, C-HA tag MG52381-CY
PON1 cDNA ORF Clone, Mouse, N-HA tag MG52381-NY
PON1 cDNA ORF Clone, Mouse, C-Myc tag MG52381-CM
PON1 cDNA ORF Clone, Mouse, N-Myc tag MG52381-NM
PON1 qPCR Primer Pairs, Mouse MP202254

PON1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PON1 cDNA ORF Clone in Cloning Vector, Human HG13083-G
PON1 cDNA ORF Clone, Human, untagged HG13083-UT
PON1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13083-ACGLN
PON1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13083-ACG
PON1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13083-ACR
PON1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13083-CF
PON1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13083-NF
PON1 cDNA ORF Clone, Human, C-His tag HG13083-CH
PON1 cDNA ORF Clone, Human, N-His tag HG13083-NH
PON1 cDNA ORF Clone, Human, C-HA tag HG13083-CY
PON1 cDNA ORF Clone, Human, N-HA tag HG13083-NY
PON1 cDNA ORF Clone, Human, C-Myc tag HG13083-CM
PON1 qPCR Primer Pairs, Human HP101700
info info
添加购物车成功! 添加购物车失败!