POMGNT1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14301-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All POMGNT1 Reagents

CRO Services

Product recommended


All POMGNT1 Reagents

POMGNT1 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1983 bp
Description
Full length Clone DNA of Human protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

POMGNT1 cDNA ORF Clone, Human, N-Myc tag Alternative Names

gnT-I.2 cDNA ORF Clone, Human;GNTI.2 cDNA ORF Clone, Human;LGMD2O cDNA ORF Clone, Human;MEB cDNA ORF Clone, Human;MGAT1.2 cDNA ORF Clone, Human

POMGNT1 Background Information

Full Name
protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)

POMGNT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
POMGNT1 cDNA ORF Clone in Cloning Vector, Mouse MG52217-G
POMGNT1 cDNA ORF Clone, Mouse, untagged MG52217-UT
POMGNT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52217-ACGLN
POMGNT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52217-ACG
POMGNT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52217-ACR
POMGNT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52217-CF
POMGNT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52217-NF
POMGNT1 cDNA ORF Clone, Mouse, C-His tag MG52217-CH
POMGNT1 cDNA ORF Clone, Mouse, N-His tag MG52217-NH
POMGNT1 cDNA ORF Clone, Mouse, C-HA tag MG52217-CY
POMGNT1 cDNA ORF Clone, Mouse, N-HA tag MG52217-NY
POMGNT1 cDNA ORF Clone, Mouse, C-Myc tag MG52217-CM
POMGNT1 cDNA ORF Clone, Mouse, N-Myc tag MG52217-NM
POMGNT1 qPCR Primer Pairs, Mouse MP202090

POMGNT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
POMGNT1 cDNA ORF Clone in Cloning Vector, Human HG14301-G
POMGNT1 cDNA ORF Clone, Human, untagged HG14301-UT
POMGNT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14301-ACGLN
POMGNT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14301-ACG
POMGNT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14301-ACR
POMGNT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14301-CF
POMGNT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14301-NF
POMGNT1 cDNA ORF Clone, Human, C-His tag HG14301-CH
POMGNT1 cDNA ORF Clone, Human, N-His tag HG14301-NH
POMGNT1 cDNA ORF Clone, Human, C-HA tag HG14301-CY
POMGNT1 cDNA ORF Clone, Human, N-HA tag HG14301-NY
POMGNT1 cDNA ORF Clone, Human, C-Myc tag HG14301-CM
POMGNT1 qPCR Primer Pairs, Human HP102951
info info
添加购物车成功! 添加购物车失败!