After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Galactolipase / PNLIPRP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PNLIPRP2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC005989
Tamanho de cDNA:1410bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens pancreatic lipase-related protein 2 with N terminal His tag.
Sinónimo de gene:PLRP2
Espécie:Human
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Galactolipase / PNLIPRP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Product nameProduct name
Fundo

Galactolipase, also known as PNLIPRP2, is a lipase with broad substrate specificity. It can hydrolyze both phospholipids and galactolipids. Galactolipase acts preferentially on monoglycerides, phospholipids and galactolipids. It also hydrolyses milk fat with a lower catalytic efficiency. The expressed galactolipase shows a lipolytic activity that is, however, only marginally dependent on the presence of colipase. The lipolytic activity of pancreatic extracts and human pancreatic juice on Labrasol is mainly due to the combined action of carboxyl ester hydrolase and galactolipase.

Referências
  • Andersson EL, et al. (2011) BSSL and PLRP2: key enzymes for lipid digestion in the newborn examined using the Caco-2 cell line. J Lipid Res. 52(11):1949-56.
  • Xiao X, et al. (2011) Pancreatic lipase-related protein-2 (PLRP2) can contribute to dietary fat digestion in human newborns. J Biol Chem. 286(30):26353-63.
  • Alves BN, et al. (2009) Lipid-dependent cytotoxicity by the lipase PLRP2 and by PLRP2-positive cytotoxic T lymphocytes (CTLs). Cell Biochem Funct. 27(5):296-308.
  • Size / Price
    Catálogo: HG13687-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"