After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PMM2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC008310
Tamanho de cDNA:741bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens phosphomannomutase 2 with N terminal HA tag.
Sinónimo de gene:PMI, CDG1, CDGS, PMI1, CDG1a, PMM 2
Espécie:Human
Vetor:pCMV3-N-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14648-ACG$225
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14648-ACR$225
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14648-ANG$225
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14648-ANR$225
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14648-CF$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14648-CH$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14648-CM$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14648-CY$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14648-G$75
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14648-NF$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14648-NH$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14648-NM$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14648-NY$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14648-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Phosphomannomutase 2, also known as PMM2 and CDG1, belongs to the eukaryotic PMM family. Phosphomannomutase 2 catalyzes the isomerization of mannose 6-phosphate to mannose 1-phosphate. Mannose 1-phosphate is a precursor to GDP-mannose necessary for the synthesis of dolichol-P-oligosaccharides. GDP-mannose can transfer its small sugar molecule called mannose to the growing oligosaccharide chain. Once the correct number of small sugar molecules are linked together to form the oligosaccharide, it can be attached to a protein. Phosphomannomutase 2 is also required for a number of critical mannosyl transfer reactions. Mutations in PMM2 gene have been shown to cause defects in the protein glycosylation pathway manifest as carbohydrate-deficient glycoprotein syndrome type I.

Referências
  • Jaeken J. et al., 2002, Annual review of genomics and human genetics. 2: 129-51.
  • Matthijs G. et al., 2000, Mol Genet Metab. 68 (2): 220-6.
  • Matthijs G. et al., 1997, Nat Genet. 16 (1): 88-92.
  • Size / Price
    Catálogo: HG14648-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"