Encomenda rápida

Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano PLK4 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_014264.4
    Tamanho de cDNA:2913bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens polo-like kinase 4 (Drosophila).
    Sinónimo de gene:SAK, STK18, PLK4
    Espécie:Human
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PLK4 qPCR primers for gene expression analysis, HP100628 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10659-ACG$325
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10659-ACR$325
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10659-ANG$325
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10659-ANR$325
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10659-CF$295
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10659-CH$295
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10659-CM$295
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10659-CY$295
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de expressão)HG10659-M$75
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10659-NF$295
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10659-NH$295
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10659-NM$295
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10659-NY$295
    Humano PLK4/SAK clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10659-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: HG10659-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"