Encomenda rápida

Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano PLAC9 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001012973.1
    Tamanho de cDNA:294bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens placenta-specific 9 with N terminal Flag tag.
    Sinónimo de gene:PLAC9
    Espécie:Human
    Vetor:pCMV3-SP-N-FLAG
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PLAC9 qPCR primers for gene expression analysis, HP102628 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13971-ACG$225
    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13971-ACR$225
    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13971-CF$195
    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13971-CH$195
    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13971-CM$195
    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13971-CY$195
    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de expressão)HG13971-G$75
    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13971-NF$195
    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13971-NH$195
    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13971-NM$195
    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13971-NY$195
    Humano PLAC9 / placenta-specific 9 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13971-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    PLAC9 belongs to the PLAC9 family. PLAC9 gene is a placental-enriched gene. There are other two placental-enriched genes: Plac1 and Plac8. Plac1 is strongly expressed in all trophoblast-derived cells in the placenta and has been described in 2000. Plac8 expression is restricted to the spongiotrophoblast layer during development, whereas PLAC9 is weakly expressed though highly enriched in placenta. For both, cDNAs with complete open reading frames were recovered and exon-intron structures inferred from comparisons of mouse cDNA and genomic sequence. The predicted proteins both contain putative signal peptides, with a coiled-coil segment of mPLAC9 as the only other detected motif. Genomic sequence comparisons reveal that in addition to an apparent pseudogene on chromosome 1, Plac8 is expressed at mouse cytoband 5e3.

    Referências
  • Deloukas P. et al., 2004, Nature. 429 (6990): 375-81.
  • Galaviz-Hernandez C. et al., 2003, Gene. 309 (2): 81-9.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Catálogo: HG13971-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"