Encomenda rápida

Text Size:AAA

Humano PI3/Elafin/WFDC14 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PI3 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:354bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens peptidase inhibitor 3, skin-derived with C terminal Myc tag.
Sinónimo de gene:ESI, WAP3, SKALP, WFDC14, cementoin, PI3
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano PI3/Elafin/WFDC14 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Product nameProduct name

Elafin, also known as Elastase-specific inhibitor, Peptidase inhibitor 3, Protease inhibitor WAP3, Skin-derived antileukoproteinase, WAP four-disulfide core domain protein 14, PI3, WAP3 and WFDC14, is a secreted protein which contains one WAP domain. Elafin / PI3 consists of two domains: the transglutaminase substrate domain (cementoin moiety) and the elastase inhibitor domain. The transglutaminase substrate domain at the N-terminus serves as an anchor to localize elafin covalently to specific sites on extracellular matrix proteins. The serine anti-protease Elafin / PI3 is expressed by monocytes, alveolar macrophages, neutrophils, and at mucosal surfaces and possesses antimicrobial activity. It is also known to reduce lipopolysaccharide-induced neutrophil influx into murine alveoli as well as to abrogate lipopolysaccharide-induced production of matrix metalloprotease 9, macrophage inhibitory protein 2, and tumor necrosis factor-alpha by as-yet unidentified mechanisms. Elafin / PI3 is a neutrophil serine protease inhibitor expressed in lung and displaying anti-inflammatory and anti-bacterial properties. Elafin / PI3 is a neutrophil and pancreatic elastase-specific inhibitor of skin. It may prevent elastase-mediated tissue proteolysis. Elafin / PI3 will regulate proteolytic enzymes during menstruation and will contribute to the innate defense against uterine infection.

Size / Price
Catálogo: HG12187-CM
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.