Encomenda rápida

Humano PHYH clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano PHYH Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC029512
    Tamanho de cDNA:1017bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens phytanoyl-CoA 2-hydroxylase with N terminal Flag tag.
    Sinónimo de gene:RD, LN1, PAHX, LNAP1, PHYH1, PHYH
    Espécie:Human
    Vetor:pCMV3-N-FLAG
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PHYH qPCR primers for gene expression analysis, HP102073 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Humano PHYH clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
    Product nameProduct name
    Fundo

    PHYH belongs to the family of iron(II)-dependent oxygenases, which typically incorporate one atom of dioxygen into the substrate and one atom into the succinate carboxylate group. PHYH is expressed in liver, kidney, and T-cells, but not in spleen, brain, heart, lung and skeletal muscle. It converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Defects in PHYH can cause Refsum disease (RD). RD is an autosomal recessive disorder characterized clinically by a tetrad of abnormalities: retinitis pigmentosa, peripheral neuropathy, cerebellar ataxia, and elevated protein levels in the cerebrospinal fluid (CSF). Patients exhibit accumulation of the branched-chain fatty acid, phytanic acid, in blood and tissues.

    Referências
  • Mihalik SJ, et al. (1997) Identification of PAHX, a Refsum disease gene. Nat Genet. 17(2): 185-9.
  • McDonough MA, et al. (2005) Structure of human phytanoyl-CoA 2-hydroxylase identifies molecular mechanisms of Refsum disease. J Biol Chem. 280(49):41101-10.
  • Jansen GA, et al. (1998) Characterization of phytanoyl-Coenzyme A hydroxylase in human liver and activity measurements in patients with peroxisomal disorders. Clin Chim Acta. 271 (2):203-11.
  • Size / Price
    Catálogo: HG13368-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"