Encomenda rápida

Humano PHYH clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PHYH Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1017bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens phytanoyl-CoA 2-hydroxylase with N terminal Flag tag.
Sinónimo de gene:RD, LN1, PAHX, LNAP1, PHYH1, PHYH
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano PHYH clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Product nameProduct name

PHYH belongs to the family of iron(II)-dependent oxygenases, which typically incorporate one atom of dioxygen into the substrate and one atom into the succinate carboxylate group. PHYH is expressed in liver, kidney, and T-cells, but not in spleen, brain, heart, lung and skeletal muscle. It converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Defects in PHYH can cause Refsum disease (RD). RD is an autosomal recessive disorder characterized clinically by a tetrad of abnormalities: retinitis pigmentosa, peripheral neuropathy, cerebellar ataxia, and elevated protein levels in the cerebrospinal fluid (CSF). Patients exhibit accumulation of the branched-chain fatty acid, phytanic acid, in blood and tissues.

  • Mihalik SJ, et al. (1997) Identification of PAHX, a Refsum disease gene. Nat Genet. 17(2): 185-9.
  • McDonough MA, et al. (2005) Structure of human phytanoyl-CoA 2-hydroxylase identifies molecular mechanisms of Refsum disease. J Biol Chem. 280(49):41101-10.
  • Jansen GA, et al. (1998) Characterization of phytanoyl-Coenzyme A hydroxylase in human liver and activity measurements in patients with peroxisomal disorders. Clin Chim Acta. 271 (2):203-11.
  • Size / Price
    Catálogo: HG13368-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.