After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PGM3 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC001258
Tamanho de cDNA:1629bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens phosphoglucomutase 3 with N terminal His tag.
Sinónimo de gene:AGM1, PAGM, PGM 3
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14852-ACG$245
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14852-ACR$245
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14852-ANG$245
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14852-ANR$245
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14852-CF$215
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14852-CH$215
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14852-CM$215
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14852-CY$215
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14852-G$75
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14852-NF$215
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14852-NH$215
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14852-NM$215
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14852-NY$215
Humano PGM3/phosphoglucomutase 3 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14852-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG14852-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"