Encomenda rápida

Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PGK1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1254bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens phosphoglycerate kinase 1 with C terminal His tag.
Sinónimo de gene:PGKA, MIG10, MGC8947, MGC117307, MGC142128, PGK1
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11114-ACG$225
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11114-ACR$225
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11114-ANG$225
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11114-ANR$225
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11114-CF$195
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11114-CH$195
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11114-CM$195
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11114-CY$195
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11114-M$75
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11114-M-F$195
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11114-NF$195
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11114-NH$195
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11114-NM$195
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11114-NY$195
Humano PGK1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11114-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
  • Rush J. et al., 2005, Nat Biotechnol. 23: 94-101.
  • Olsen JV. et al., 2006, Cell. 127: 635-648.
  • Zieker D. et al., 2008, Cell Physiol Biochem. 21 (5-6): 429-36.
  • Jung Y. et al., 2009, Mol Cancer Res. 7 (10): 1595-604.
  • Choudhary C. et al., 2009, Science. 325: 834-40.
  • Size / Price
    Catálogo: HG11114-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.