Encomenda rápida

Humano Pepsinogen C/PGC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano PGC Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1167bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens progastricsin (pepsinogen C) with C terminal HA tag.
Sinónimo de gene:PEPC, PGII, FLJ99563, PGC
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
( We provide with PGC qPCR primers for gene expression analysis, HP101601 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Pepsinogen C, also known as PGC, is an aspartic proteinase that belongs to the peptidase family A1. Pepsinogen C is synthesized in the gastric mucosa as inactive precursors, known as zymogens. Pepsinogen C contains a prosegment that serves to stabilize the inactive form and prevent entry of the substrate to the active site. At low PH conditions, Pepsinogen C undergoes conversion into active enzyme. Pepsinogen C has been found expressed in all regions of the stomach mucosa and also in the proximal duodenal mucosa. In stomach cancer tissues and cancer cell lines, the expressions of the pepsinogen genes were decreased or lost, in good accordance with their pepsinogen productions. No gross structural changes of the pepsinogen genes were observed in these cancers, but the methylation patterns of the pepsinogen genes were found to be altered in different ways in different cancers. Serum levels of Pepsinogen C are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis.

  • Richter C, et al. (1998) Mechanism of activation of the gastric aspartic proteinases: pepsinogen, progastricsin and prochymosin. Biochem J. 1 (335): 481-90.
  • Westerveld BD, et al. (1987) Gastric proteases in Barrett's esophagus. Gastroenterology. 93 (4): 774-8.
  • Ichinose M, et al. (1991) Methylation and expression of human pepsinogen genes in normal tissues and their alteration in stomach cancer. Jpn J Cancer Res. 82 (6): 686-92.
  • Size / Price
    Catálogo: HG12072-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.