Encomenda rápida

Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

  • other Green fluorescent protein / GFP Gene Plasmid Map 5611
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano PFKM Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC021203
Tamanho de cDNA:2388 bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens phosphofructokinase, muscle with C terminal Myc tag.
Sinónimo de gene:GSD7, MGC8699, PFK-1, PFK1, PFKA, PFKX, PFKM
Espécie:Human
Vetor:pCMV3-C-Myc
Plasmid:pCMV3-PFKM-Myc
Local de restrição:KpnI + XbaI(pCMV3-C-Myc-KpnI-XbaI)
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PFKM qPCR primers for gene expression analysis, HP102786 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14133-ACG$245
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14133-ACR$245
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14133-ANG$245
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14133-ANR$245
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14133-CF$215
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14133-CH$215
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14133-CM$215
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14133-CY$215
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de expressão)HG14133-G$75
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14133-NF$215
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14133-NH$215
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14133-NM$215
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14133-NY$215
Humano PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14133-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

PFK1, also known as PFKM, is a regulatory glycolytic enzyme. PFK1 converts fructose 6-phosphate and ATP into fructose 1,6-bisphosphate (through PFK-1), fructose 2,6-bisphosphate (through PFK-2) and ADP. It is a muscle-type isozyme. There are three phosphofructokinase isozymes in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Mutations in PFK1 gene have been related with glycogen storage disease type VII, also identified as Tarui disease.

Size / Price
Catálogo: HG14133-CM
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Acrescentar a carrinhoBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"