Encomenda rápida

Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PFKFB4 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1410bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 with C terminal His tag.
Sinónimo de gene:PFKFB4
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11123-ACG$225
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11123-ACR$225
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11123-ANG$225
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11123-ANR$225
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11123-CF$195
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11123-CH$195
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11123-CM$195
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11123-CY$195
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11123-M$75
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11123-M-F$195
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11123-M-N$195
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11123-NF$195
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11123-NH$195
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11123-NM$195
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11123-NY$195
Humano PFKFB4 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11123-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG11123-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.