After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PFDN4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC010953
Tamanho de cDNA:405bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens prefoldin subunit 4 with C terminal Myc tag.
Sinónimo de gene:C1, PFD4, PFDN4
Espécie:Human
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14144-ACG$225
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14144-ACR$225
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14144-ANG$225
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14144-ANR$225
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14144-CF$195
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14144-CH$195
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14144-CM$195
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14144-CY$195
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14144-G$75
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14144-NF$195
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14144-NH$195
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14144-NM$195
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14144-NY$195
Humano PFDN4 / PFD4 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14144-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

PFDN4 is a member of the prefoldin beta subunit family. It is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. PFDN4 binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it. PFDN4 also binds to nascent polypeptide chain and promotes folding in an environment in which there are many competing pathways for nonnative proteins.

Referências
  • Iijima M, et al. (1996) Cloning of cDNA with possible transcription factor activity at the G1-S phase transition in human fibroblast cell lines. Acta Med Okayama. 50(2):73-7.
  • Hartl FU, et al. (2002) Molecular chaperones in the cytosol: from nascent chain to folded protein. Science. 295(5561):1852-8.
  • Vainberg I, et al. (1998) Prefoldin, a chaperone that delivers unfolded proteins to cytosolic chaperonin. Cell. 93(5):863-73.
  • Size / Price
    Catálogo: HG14144-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"