After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PDRG1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC009334
Tamanho de cDNA:402bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens p53 and DNA-damage regulated 1 with C terminal Myc tag.
Sinónimo de gene:RP1-310O13.8, C20orf126, PDRG, PDRG1
Espécie:Human
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14143-ACG$225
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14143-ACR$225
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14143-ANG$225
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14143-ANR$225
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14143-CF$195
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14143-CH$195
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14143-CM$195
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14143-CY$195
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14143-G$75
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14143-NF$195
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14143-NH$195
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14143-NM$195
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14143-NY$195
Humano PDRG1 / C20orf126 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14143-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

PDRG1, also known as C20orf126, belongs to the prefoldin subunit beta family. It is predominantly expressed in normal testis and exhibits reduced but detectable expression in other organs. PDRG1 may play a role in chaperone-mediated protein folding. PDRG1 is overexpressed in tumors relative to normal tissues. Its expression is upregulated in multiple malignancies including cancers of the colon, rectum, ovary, lung, stomach, breast and uterus when compared to their respective matched normal tissues. Thus PDRG1 is a high-value novel tumor marker that could play a role in cancer development and/or progression.

Referências
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Jiang L. et al., 2011, Cancer Biol Ther. 11 (6): 567-73.
  • Size / Price
    Catálogo: HG14143-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"