Encomenda rápida

Humano PDGFRA/CD140a clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

  • Human PDGFRα natural ORF mammalian expression plasmid, N-Flag tag
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano PDGFRA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:3270bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens platelet-derived growth factor receptor, alpha polypeptide with N terminal Flag tag.
Sinónimo de gene:CD140A, PDGFR2, MGC74795, Rhe-PDGFRA
Local de restrição:HindIII + NotI (6kb + 3.29kb)
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 534 C/T, 1719 A/G, 3240 T/C not causing the amino acid variation.
( We provide with PDGFRA qPCR primers for gene expression analysis, HP100568 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano PDGFRA Gene Plasmid Map
Human PDGFRα natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano PDGFRA/CD140a clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Product nameProduct name

PDGFRA, also known as CD140a, together with the structurally homolog protein PDGFRB (CD140b), are cell surface receptors for members of the platelet-derived growth factor family. They are members of the class III subfamily of receptor tyrosine kinase (RTKs) with the similar structure characteristics of five immunoglobulin-like domains in their extracellular region and a split kinase domain in their intracellular region. PDGFRA is expressed in oligodendrocyte progenitor cells and mesothelial cell, and binds all three ligand isoforms PDGF-AA, PDGF-BB and PDGF-AB with high affinity, whereas PDGFRB dose not bind PDGF-AA. PDGFRA plays an essential role in regulating proliferation, chemotaxis and migration of mesangial cells. Recent studies have indicated that PDGFRA acts as a critical mediator of signaling in testis organogenesis and Leydig cell differentiation, and in addition, particularly important for kidney development. Additionally, PDGFRA is involved in tumor angiogenesis and maintenance of the tumor microenvironment and has been implicated in development and metastasis of Hepatocellular carcinoma (HCC). PDGFRA may represent a potential therapeutic target in thymic tumours. PDGFRA gene amplification rather than gene mutation may be the underlying genetic mechanism driving PDGFRA overexpression in a portion of gliomas.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Oseini AM, et al. (2009) PDGFRalpha: a new therapeutic target in the treatment of hepatocellular carcinoma? Expert Opin Ther Targets. 13(4): 443-54.
  • Meister M, et al. (2009) Expression and mutational status of PDGFR in thymic tumours. Anticancer Res. 29(10): 4057-61.
  • Martinho O, et al. (2009) Expression, mutation and copy number analysis of platelet-derived growth factor receptor A (PDGFRA) and its ligand PDGFA in gliomas. Br J Cancer. 101(6): 973-82.
  • Size / Price
    Catálogo: HG10556-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.